Week 2 Overview
This week we will look at the crystal structure of cystathionine b-lyase (CBL) bound to PLP and a covalent inhibitor aminothoxyvinylglycine (AVG). Our goal is to better understand the chemical mechanism and specificity of the enzymatic reaction.
Part 1: Learning how to look at crystal structures.
We will be using powerful visualization software available from the University of Illinois called Visual Molecular Dynamics (VMD). This is found in a folder in the course materials section of the server. Your pre-lab assignment had you work through a tutorial using the software.
In lab we will use the software to look at the structure of CBL. The file for this structure was published by Clausen et al, Biochemistry, 36, 12633 and is titled "1CL2.pdb". We will begin looking for the active site. The active site has been covalently modified with AVG. Look for Lys 210 or the residue titled "PPG". This image may represent the "ES" form during the catalytic reaction as illustrated below:

Look carefully at the structure and take some time to identify portions of the enzyme that are in proximity to the "substrate". Use Figure 7 from the Clausen paper to help orient you.
There are many selection tricks you may want to use to look at the structure.
· You can select residues within a certain number of angstroms of an atom or molecule using a command line such as: "within 10 of resname PPG" in the graphics display window. This will display atoms within 10 angstroms of residue PPG.
· You can add labels to atoms and amino acids using the "mouse" pull down menu in the VMD main menu. Click "mouse" then "label" then "atoms". Using the cross hairs point to the atom and double click. By touching the "r" key on the keyboard you can go back to rotate model to get a better view.
Atom labels can be removed by going back to the VMD main menu and clicking "graphics" then "labels". Here you can delete labels.
Begin formulating a hypothesis "I think it works this way..." with regard to how specific amino acids play a role in either the reaction mechanism or in the substrate specificity. When you are ready to go, write out your hypothesis in your notebook.
Part 2: Design the mutant.
Once you know what mutation you want to try, for example W131A, look at the DNA sequence of the protein (text file pET21b-CBL coding strand.txt on the server). This is the ssDNA sequence of the expression plasmid (pET21b) with the His6-tagged protein included (mostly lower case letters) created by the helper phage. Unfortunately, it does not reflect that all of the thymidylate should be uridylate (please use your imagination here). Look towards the end of the sequence for the lower case text, you will see the start codon written as “atg”, the His-tag as a series of "cac" and the stop codon reads “tga”. We will be using this file and copying portions of it into EMBOSS, a suite of programs that help us manipulate DNA.
Useful software for DNA manipulations, restriction site mapping, translations and mutation design.
http://data.genomics.purdue.edu/EMBOSS/
There is a lot of information here. Along the left edge of the screen is an alphabetical listing of all the programs.
Under NUCLEIC TRANSLATION “showseq” will display a sequence with translation (multiple frames available), numbering, complement and restriction sites
At this point, you can correlate each amino acid in the protein sequence to the corresponding DNA sequence. For instance W131 corresponds to the tgg codon. Notice that the single letter amino acid is at the start of the codon. Now, figure out which mutation you want to make and how the corresponding codon needs to change. Write this out in your notebook.
Part 3: Try to design a "silent" mutant using one of two methods
We would like to have a straightforward way to know that we have made the mutation without having to do DNA sequencing. A nice way to do this is to introduce a second mutation that either adds or removes a restriction site (a unique place where an enzyme cuts the DNA). However, we need to do this second mutation without changing the amino acid sequence of the protein! Such mutations are called "silent" mutations. We need to either add a site or remove a site, not both!
If you choose to try to add a restrictions site:
Procedure for adding a restriction site
Under NUCLEIC RESTRICTION “silent” will display all of the silent mutations possible in a given sequence
For the W131A mutation I copied this sequence "gtaacgacatcatggtttgatccgctg"
I then changed the sequence to "gtaacgacatcagcgtttgatccgctg" now coding for alanine at position 131
You will obtain a table with a variety of potential silent mutants and a list of restriction enzymes that will allow you to test this change. Which one to choose depends on the following criteria:
1) How close is the silent mutation to the site you already want to mutate? Closer is better. The table lists the "base position". This is the position in the sequence you copied into "silent". In the example above, the mutated codon is at base position 13-15. Begin looking at the enzymes listed near positions 13-15. Hint enzymes listed with a longer sequence under the RS-pattern column (restriction sequence) tend to be more specific and therefore more useful.
For my example, all of the enzymes at position 12 only recognized a four base sequence; I knew these would be very non-specific (see notes below). Instead I chose to look at some of the mutations at position 9.
Next I noted that there were a lot of enzymes that could work if position 9 were mutated A->G (last column in the table)
Now it was time to test the changes on the complete plasmid.
2) Adding a restriction site that "smashes" the plasmid will not be useful. We generally can deal with an enzyme that digests the plasmid 5 or fewer times.
In my example, I found the enzyme AatII cut the mutant plasmid one time. I double checked the digest of the parent pET21.-CBL coding strand and found AatII didn't cut at all.
3) Is the restriction enzyme commercially available at a reasonable cost? To find this out, go to New England Biolabs website www.neb.com and check.
AatII was $53 for 500 units; it is not a bad choice
The final sequence I need in my plasmid would be "gtaacgacgtcagcgtttgatccgctg" I expect AatII to not cut the parent or non-mutant plasmid and there to be a single cut if the mutation were present.
If adding a restriction site didn't work out:
Procedure for removing a restriction site
Under NUCLEIC RESTRICTION “recoder” will display all of the restriction sites within a sequence and the mutations possible to remove them without changing the coding sequence
Work through a similar analysis as above to make the best choice for your plasmids.
For the W131A mutation I copied this sequence "gtaacgacatcatggtttgatccgctg"
I then changed the sequence to "gtaacgacatcagcgtttgatccgctg" now coding for alanine at position 131 and copied it into "recoder"
You will obtain a table with a variety of potential mutants and a list of restriction enzymes that will no longer digest the sequence. The quickest way to evaluate the results is to use NEB cutter to digest the parent plasmid, list all the enzymes that cut <=5 times. If one of the enzymes is listed in both places, you know that the mutation will result in a noticeable change between the parent and the desired mutant.
For the example above, there was no good choice for removing a restriction site.
Part 4: Ordering
We must order a DNA oligonucleotide that is the reverse complement of the 20-30 nucleotide fragment we just designed. Under EDIT “revseq” will give you the reverse complement of an inputted sequence. Alternatively, you can do this by hand. Be sure to copy this sequence into your notebook. Complete the attached sheet before leaving the lab today.